wolfgang
-
Posts
806 -
Joined
-
Last visited
-
Days Won
11
Content Type
Profiles
Forums
Events
Gallery
Blogs
Everything posted by wolfgang
-
I wrote it out and used trail and error. I think it works. the robot starts on three and will dig twelve holes Super!!!! very good!!
-
Draw a circle ,devide it into 12 points,give each point a number (1 to 12) according to your own stratigy. A robot will fly around this circle in one direction(clockwise ),when he stops on a given point he will dig a hole there!...so the robot will do these steps repeatedly: 1-read the number standing on. 2-dig a hole. 3-fly so many steps according to number from step 1. 4- go to 1 the mission will fail if the robot falls into a hole.. Start the mission by placing the robot on any point of your choice,,,press...GO..!!and the robot will do his job perfectly as written above. Try to make a strategy which will lead to dig maximal number of holes. The number standing on will not be counted....for example: if your numbers where, 8..2..12..5..3.....etc., if you decided to put the robot on number 2 as a start point...so 1-read..(2) 2-dig a hole in this place. 3-fly to (5). 4-go to 1 1-read (5)....and so on.....
-
Cadaeibfecehigic.........
-
Six persons(one of them is my son), the age difference between one and other is 3 years,the older one is 30 years old. 2 of them play Foot ball,2 play Chess,and 2 play Table Tennis 2 of them eat Meat,2 eat Potatoes,and 2 eat Fish 2 of them drink water,2 drink Fanta,and 2 drink Cola 2 of them wear yellow shirts,2 green shirts,and 2 red shirts a- Age difference between:- ....chess players=9 years ...Table tennis players= 3 years ...Fish eaters= 12 years ...the two wearing yellow shirts = 15 years b-Meat eaters drink different drinks,but not water c-Potatoes eaters play different plays other than chess d-water drinkers wear different shirts ,but not red. e-Fanta drinkers wear the same shirt color,other than green. f-Cola drinkers have nothing else similar. g-Foot ball players will soon resign. The one who drinks water is my son....tell me more about him.... NoteTwo years ago my wife and I celebrated the anniversary of our 25 years marriage .
-
I made a puzzle which has no solution (as far as I tried), Is it possible to solve it? Draw a pentagonal star(see attached file). Give Numbers(1 to 10) for each point, each number should come only once. so that the sum of four numbers on each straight line is equall to sum of each 4 numbers on the other lines.
-
Woooow...Great......thank you dear...
-
On my chromosome you will find a special gene with this code:- CGAACACTGGCATCAATCCACTGCGCATAGACAGACTGCCACATGGTCCGAATCGATAGTGAG Can you decode it? Note: The codes( ACA and CAC) are termination codes.
-
Great...!!
-
Thank you all...hope you enjoyed it..
-
Other posts are pretty much there, but surely this would be the easierst way. Very good!!
-
Very good...!!
-
If you have a piece of ruler( without graduations)which is 26 cm long. How can you draw a 29 cm long striaght line on a white paper using this ruler only? you are not allowed to break the ruler or cut any piece of the paper, the paper is irregular in shape but lagre enough. (near to 29 is acceptable)...i.e. the difference should be < 0.1
-
Very good !!! Nana7
-
A man died and left his three sons 15 pots. 5 filled with honey. 5 with olive oil. and 5 with red wine. How can you devide these pots between them fairly,knowing that:- 1- price of one pot honey =price of 1.5 pots olive oil. 2- price of one pot olive oil =price of two pots red wine.
-
Great!!!
-
John had 5 Oranges, and Peter had 3 oranges. They preesd them and made an orange juice,then they diluted it with 1/3 liter soda water. Paul joined them and wanted to drink from this juice also,and to pay for it. They devided the whole quantity into 3 equall parts, each one of them drunk his part of juice. Paul paid them 8 $,and went away. How can you devide the money FAIRLY between John and Peter? give your reason.
-
Yeah....correct!! So... Tom has only 1$ and is the truth teller Jim is the lier,having 20$. And Sam (the rich one) has 39$,he can either lie or tell the truth( as he did in this case).
-
Sam, Tom ,and Jim are three brothers having a total amount of 60$. The one with minimal amount of money always tells the truth,the other with average amount of money always lies, and the one with the large portion of money can either lie or tell the truth. Sam says: Tom is poor. Tom says: Jim is a lier. Jim says: I am rich!! Howmuch money has each one of them? Who is who?(truth teller,lier and random teller?)
-
Very good..
-
There are 9 Flasks infront of me(no one is empty),each Flask contains a different number of beads either red or blue(but not a mixture and No flask has more than 9 beads in it). The flasks are given numbers 1 to 9. Number of beads in flasks:- 1+2=9 mixed beads 2+3=10 blue beads 3+4=13 blue beads 4+5=11 mixed beads 5+6=7 red beads 6+7=4 red beads 7+8=12 mixed beads 8+9=? mixed beads Arrenge the Flasks from higher to lower,which beads are more..red or blue?
-
That was really easy....
-
Steve collects coins(but only the small ones!!..1 cent...2cents..and 5 cents).After few weeks he reached(n)number of the three types,where, 73< n < 93. He noticed that : The Total value of all coins(in Cents) = Total weight of all coins (in grams) 1- find (n)? 2- find number of 1 cent coins,2 cents,and 5 cents in this mixture(they are different numbers). knowing that: 1 cent = 2 gm 2 cents = 3 gm 5 cents = 4 gm
-
If n=5 so.. 5+3 = 8 which is a perfect cube 5^2 +3= 28 28= 27+1( and both are perfect cubes)
-
-
The street was (one way),that means,he can not drive close to the entrance and wait to see weather it is possible or not....cause there are another cars on the road.
