-
Posts
806 -
Joined
-
Last visited
-
Days Won
11
Content Type
Profiles
Forums
Events
Gallery
Blogs
Posts posted by wolfgang
-
-
Draw a circle ,devide it into 12 points,give each point a number (1 to 12) according to your own stratigy.
A robot will fly around this circle in one direction(clockwise ),when he stops on a given point he will dig a hole there!...so the robot will do these steps repeatedly:
1-read the number standing on.
2-dig a hole.
3-fly so many steps according to number from step 1.
4- go to 1
the mission will fail if the robot falls into a hole..
Start the mission by placing the robot on any point of your choice,,,press...GO..!!and the robot will do his job perfectly as written above.
Try to make a strategy which will lead to dig maximal number of holes.
The number standing on will not be counted....for example:
if your numbers where, 8..2..12..5..3.....etc.,
if you decided to put the robot on number 2 as a start point...so
1-read..(2)
2-dig a hole in this place.
3-fly to (5).
4-go to 1
1-read (5)....and so on.....
-
Cadaeibfecehigic.........
-
Six persons(one of them is my son), the age difference between one and other is 3 years,the older one is 30 years old.
2 of them play Foot ball,2 play Chess,and 2 play Table Tennis
2 of them eat Meat,2 eat Potatoes,and 2 eat Fish
2 of them drink water,2 drink Fanta,and 2 drink Cola
2 of them wear yellow shirts,2 green shirts,and 2 red shirts
a- Age difference between:-
....chess players=9 years
...Table tennis players= 3 years
...Fish eaters= 12 years
...the two wearing yellow shirts = 15 years
b-Meat eaters drink different drinks,but not water
c-Potatoes eaters play different plays other than chess
d-water drinkers wear different shirts ,but not red.
e-Fanta drinkers wear the same shirt color,other than green.
f-Cola drinkers have nothing else similar.
g-Foot ball players will soon resign.
The one who drinks water is my son....tell me more about him....
NoteTwo years ago my wife and I celebrated the anniversary of our 25 years marriage .
-
I made a puzzle which has no solution (as far as I tried),
Is it possible to solve it?
Draw a pentagonal star(see attached file).
Give Numbers(1 to 10) for each point, each number should come only once.
so that the sum of four numbers on each straight line is equall to sum of each 4 numbers on the other lines.
-
I LOVE YOU MY FRIENDS
Woooow...Great......thank you dear...
-
On my chromosome you will find a special gene with this code:-
CGAACACTGGCATCAATCCACTGCGCATAGACAGACTGCCACATGGTCCGAATCGATAGTGAG
Can you decode it?
Note:
The codes( ACA and CAC) are termination codes.
-
Draw a 26 CM line. Now fold the paper such that two ends of the line meet together. This will mark a perpendicular bisector of the line. Starting at the midpoint of this line, draw another 26 cm line along the perpendicular bisector. Complete a right angle triangle with one side as 26cm (2nd line) and another as 13cm (any half of first line). The hypotenuse is of 29.06 cm.
Great...!!
-
Thank you all...hope you enjoyed it..
-
You draw a line the 26 cm of the ruler.
Then fold the paper using the line as a guide (this way you can find the half way point accurately and create a perpendicular line [not parallel as previously mentioned, an easy mix-up of words..])
At the mid-way point draw another 26 cm line up the fold - Joining up the end points will give a triangle with a hypotenuse of 29.07 cm. You might need a longer straight edge to actually draw the line though...
Other posts are pretty much there, but surely this would be the easierst way.
Very good!!
-
First, draw a 26 cm line. Then try to aim for a 13 cm line, which will be up to half the ruler... Start drawing the second line at the ending point to the first line and parallel to it. These steps will result in having an L shaped figure. Now, just make a third line connecting the starting point of the first line, with the ending point of the second line.
If you perfectly hit the 13 cm mark on the ruler, the resulting third line will be 29.0689 cm long.
Very good...!!
-
If you have a piece of ruler( without graduations)which is 26 cm long.
How can you draw a 29 cm long striaght line on a white paper using this ruler only?
you are not allowed to break the ruler or cut any piece of the paper, the paper is irregular in shape but lagre enough.
(near to 29 is acceptable)...i.e. the difference should be < 0.1
-
There are many ways to divide them up fairly.
To start, find value of pots. If oil = 2 wine and honey = 1.5 oil, then honey = 3 wine. For ease of calculation, I will assign wine a value of 1, so oil = 2 and honey = 3. With 5 pots of each, total values are 15 for honey, 10 for oil, and 5 for wine, combined for 30 for all pots. So each should recieve something that totals a value of 10. For my solution I decided that they should also each recieve at least one pot of each type.
1 recieves 1 honey, 3 olive oil, 1 red wine, total value 3+6+1=10
2 recieves 2 honey, 1 olive oil, 2 red wine, total value 6+2+2=10
3 recieves 2 honey, 1 olive oil, 2 red wine, total value 6+2+2=10
Very good !!! Nana7
-
A man died and left his three sons 15 pots.
5 filled with honey.
5 with olive oil.
and 5 with red wine.
How can you devide these pots between them fairly,knowing that:-
1- price of one pot honey =price of 1.5 pots olive oil.
2- price of one pot olive oil =price of two pots red wine.
-
It is:
7$ to John
1$ to Peter
EXplanation:
Divide juice from a orange into three parts.
So John have 15 unit juice
Peter have 9 unit juice.
Total juice = 24 units
Each drink equally hence they drink = 8 units
Now John have 15 units, while he drank 8 units.
Hence 7 units juice from his were drank by either Peter or Paul.
Peter have 9 units, he drank 8 units,
Hence only 1 unit juice of his were wither drank by John or Paul.
Great!!!
-
John had 5 Oranges, and Peter had 3 oranges.
They preesd them and made an orange juice,then they diluted it with 1/3 liter soda water.
Paul joined them and wanted to drink from this juice also,and to pay for it.
They devided the whole quantity into 3 equall parts, each one of them drunk his part of juice.
Paul paid them 8 $,and went away.
How can you devide the money FAIRLY between John and Peter? give your reason.
-
Sam can not be the honest one since that would make him poor, and his claim false.
Jim can not be the honest one for the same reason.
Tom is honest and poor. Jim is the lier and has modest money. Sam is rich and happened to tell the truth about Tom.
As for amounts, if the modest amount is average, then it is 20. The poor and rich amounts have to add to be 40.
Assuming "minimal" amount of money means least possible, Tom has 0 dollars and Sam has 40. If minimal means to actually have at least one dollar, then Tom has 1 dollar and Sam has 39.
I misread minimal to just mean small last time rather than minimum.
Yeah....correct!!
So...
Tom has only 1$ and is the truth teller
Jim is the lier,having 20$.
And Sam (the rich one) has 39$,he can either lie or tell the truth( as he did in this case).
-
Sam, Tom ,and Jim are three brothers having a total amount of 60$.
The one with minimal amount of money always tells the truth,the other with average amount of money always lies, and the one with the large portion of money can either lie or tell the truth.
Sam says: Tom is poor.
Tom says: Jim is a lier.
Jim says: I am rich!!
Howmuch money has each one of them?
Who is who?(truth teller,lier and random teller?)
-
831549726
R=21, B=24
Very good..
-
There are 9 Flasks infront of me(no one is empty),each Flask contains a different number of beads either red or blue(but not a mixture and No flask has more than 9 beads in it).
The flasks are given numbers 1 to 9.
Number of beads in flasks:-
1+2=9 mixed beads
2+3=10 blue beads
3+4=13 blue beads
4+5=11 mixed beads
5+6=7 red beads
6+7=4 red beads
7+8=12 mixed beads
8+9=? mixed beads
Arrenge the Flasks from higher to lower,which beads are more..red or blue?
-
That was really easy....
-
Steve collects coins(but only the small ones!!..1 cent...2cents..and 5 cents).After few weeks he reached(n)number of the three types,where, 73< n < 93.
He noticed that :
The Total value of all coins(in Cents) = Total weight of all coins (in grams)
1- find (n)?
2- find number of 1 cent coins,2 cents,and 5 cents in this mixture(they are different numbers).
knowing that:
1 cent = 2 gm
2 cents = 3 gm
5 cents = 4 gm
-
If n=5
so..
5+3 = 8 which is a perfect cube
5^2 +3= 28
28= 27+1( and both are perfect cubes)
-
n= 1
-
From the problem statement, there is no way we can measure the height of the tunnel throughout its entire length! So, all we are trying to measure is the height at the entrance of the tunnel. In that case, isn't is just simpler and more practical to drive as close as possible to the entrance (without getting stuck, of course) and use eye estimation at that point? All this trigonometry stuff with a cigarette held at arms length and no other measuring tools will give a very rough order of estimate anyway.
The street was (one way),that means,he can not drive close to the entrance and wait to see weather it is possible or not....cause there are another cars on the road.
in New Logic/Math Puzzles
Posted
Super!!!!
very good!!