wolfgang Posted July 31, 2011 Report Share Posted July 31, 2011 On my chromosome you will find a special gene with this code:- CGAACACTGGCATCAATCCACTGCGCATAGACAGACTGCCACATGGTCCGAATCGATAGTGAG Can you decode it? Note: The codes( ACA and CAC) are termination codes. Quote Link to comment Share on other sites More sharing options...
0 superprismatic Posted July 31, 2011 Report Share Posted July 31, 2011 I LOVE YOU MY FRIENDS Quote Link to comment Share on other sites More sharing options...
0 Guest Posted July 31, 2011 Report Share Posted July 31, 2011 I LOVE YOU MY FRIENDS how did you get that answer? Quote Link to comment Share on other sites More sharing options...
0 superprismatic Posted August 1, 2011 Report Share Posted August 1, 2011 how did you get that answer? After removing the termination codes, the pattern of triads is A BCDE FCG HF IJAEKLM and I solved it like a normal cryptogram which you see in newspapers. I saw that I LOVE YOU MY FRIENDS is a valid solution and, knowing the way Wolfgang seems to be on this forum, I figured it was correct. Quote Link to comment Share on other sites More sharing options...
0 wolfgang Posted August 1, 2011 Author Report Share Posted August 1, 2011 I LOVE YOU MY FRIENDS Woooow...Great......thank you dear... Quote Link to comment Share on other sites More sharing options...
Question
wolfgang
On my chromosome you will find a special gene with this code:-
CGAACACTGGCATCAATCCACTGCGCATAGACAGACTGCCACATGGTCCGAATCGATAGTGAG
Can you decode it?
Note:
The codes( ACA and CAC) are termination codes.
Link to comment
Share on other sites
4 answers to this question
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.